Use the search GenBank box on the NCBI homepage with accession number U00089 to retrieve the CON division
record for the complete Mycoplasma pneumoniae complete genome. How many GenBank records make up this
record? Use the display pull-down list to change to the graphic view to see graphically how these segments map
and features map onto the sequence.
Retrieve the draft record AC013402. How many unordered pieces are in the record now?
How many times has it been updated since it first appeared. Trace the history all the
way back to the first version. Based on the update date when did this record first appear
How many unordered pieces were there then? Now use electronic PCR (linked as a "hotspot"
on the NCBI homepage to identify STS markers present in this record. How many are there?
These include radiation hybrid and genetic markers. Which one is also a genetic marker?
The Entrez Properties field stores information about the kind of sequence and its source. You can use the
the index feature on the Preview/Index tab to display the terms that are indexed for this field. Use the
gbdiv sets of terms to count the number of records currently the HTG, GSS, EST, HTC divisions
(e.g. gbdiv est[Properties]). Use the molecule type term biomol to count the number of mRNA and genomic DNA
records in Entrez nucleotides (e.g. biomol mrna[Properties].
Devise a query to retrieve the ten largest human genomic
sequences. (You may specify this as "Sequence Length" range with the second
end point as some arbitrarily large number e.g. 999999999). The largest of
these, those with NT_xxxxx style accession number will be RefSeq contigs
from the human genome project data. Now find the ten largest single (not
contig records) human sequences in the nucleotide database. You can do this
by "NOTing" out the RefSeq records using the srcdb terms of the Properties field. Now find the largest finished single
human record.
-
Use the program BLAST 2 Sequences to compare the RefSeq mRNA for CFTR (NM_000492) with the model transcript (XM_004980)
predicted from the human genome. Are there any mismatches? Now compare the original GenBank sequence for the CFTR mRNA (M28668) to
the RefSeq and note any differences in sequence.
Use Entrez
nucleotides to find the
full-length cDNA (mRNA) sequence for Plasmodium falciparum glyceraldehyde 3 phosphate
dehydrogenase (GAPD). This time start by typing Plasmodium in the search box without limiting to
any field. How many records do you retrieve? Browse through your results to find some records
that are not from Plasmodium. Display a few of these to see why you retrieved then; you should
find "Plasmodium" somewhere on the record. Now use the Limits tab to restrict to
Plasmodium in the Organism field [Organism]. How many nucleotide records in Entrez are from
Plasmodium? Now find GAPD records by using the
Preview/Index tab to add glyceraldehyde 3 phosphate dehydrogenase as a Title Word term.
How many records did you retrieve?
Search for population and phylogenetic studies on the mammalian order carnivora in Entrez PopSet. Find the study on brown
bears and polar bears and display the alignment. What gene or molecular regions were used in this study? Use the tool bar
link to display variations in the alignment. Are there fixed differences in the sequences from the brown bear, Ursus
arctos, and the polar bear sequences in the alignment? How about if the Ursus arctos sequence from the "ABC" islands
islands (Sequence 7) is removed. Link to the article to read more about these remarkable results.
Go back to the original set of carnivora PopSets.
Substantial EST data are available for two species of filarial
nematodes that are human parasites. Use the Taxonomy Browser to examine the
number of nucleotide sequences for the superfamily Filaroidea and determine
which two species these are. How many nucleotide and protein sequences are
there for each of these two species? Examine nucleotide records for each of
these and find which laboratory is producing these ESTs.
The last known Tasmanian tiger died in the Hobart Zoo in 1936. DNA sequences have been
obtained from museum specimens. You can retrieve tasmanian tiger sequences
using the Taxonomy Browser.
Search the taxonomy database for Tasmanian Tiger. How many DNA and protien sequences are there? What genes were cloned?
You can build a phylogenetic data set that could be used to analyze the taxonomic position of the Tasmanian Tiger with
the Taxonomy Browser. Click on the Metatheria (Marsupial) link in the lineage of the tiger. How many nucleotide
sequences are there for Metatheria? Retrieve the entry for Metatheria and get the nucleotide sequences. In Entrez you can refine the
query to include only cytochrome b sequences through the Preview/Index tab. How many marsupial cytochrome b sequences
are there? You could save these in FASTA format for use in phylogenetic
analysis if you wanted. You could browse up the
lineage further to get an outgroup sequence
Use
Entrez Structures
to retrieve the xray crystal structure of the oxidized form of bovine cytochrome B5 (1CYO).
View the structure with Cn3D. Locate the the iron atom in the heme complex. Which two amino acids
coordinate with the iron? Align the yeast cytochrome B5 sequence (accession number P40312) using the
the "Download Sequence" option on the "Align" menu on the sequence view window. You will first have to configure Cn3D as a network client.
Do this by selecting Net Configure from the "Options" menu of the structure viewer. Click the normal
radio button and click "Accept", then re-start Cn3D.
Use Entrez structures to retrieve the structure record for the
human VH-1-related phosphatase (1VHR). View the structure with Cn3D. How
many chains are in the asymmetric unit of this crystal structure? How many
alpha helices and beta strands are present in each of the subunits? Close
out that invocation of Cn3d. Find structure neighbors for 1VHR chain A. How
much identity does the phosphatase from Yersinia have with 1VHR_A?
Display the alignment of these two proteins with Cn3d. Select all atoms and
all display only aligned chains. Note that the sulfate ion bound by 1YTS is
now nearly superimposed on the phosphate of the substrate analog in 1VHR.
Zoom into this region. (Click Ctrl and drag mouse.) There is a conserved
catalytic nucleophile in the active site of both of the proteins (a serine
in one and a cysteine in the other). Identify the nucleophile by
highlighting the cysteines in the alignment and displaying side chains in
the viewer.
- Michael Crichton's fantasy about cloning dinosaurs, Jurassic Park contains a putative dinosaur DNA sequence.
Use nucleotide-nucleotide BLAST against the default nucleotide database to identify the real source
of the following sequence:
>DinoDNA "Dinosaur DNA" from Crichton's JURASSIC PARK p. 103 nt 1-1200
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG
TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG
CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA
AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG
ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT
CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT
GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG
CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA
CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG
ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA
ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC
GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG
CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG
CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT
Mark Boguski of the NBCI noticed this and supplied Crichton with a better sequence
for the sequel, The Lost World. Identify the most likely source of
this sequence using nucleotide-nucleotide BLAST. Mark imbedded his name in
the sequence he provided. To see Mark's name use the translating BLAST (blastx) page
the sequence below. (Look for MARK WAS HERE NIH).
>DinoDNA "Dinosaur DNA" from Crichton's THE LOST WORLD p. 135
GAATTCCGGAAGCGAGCAAGAGATAAGTCCTGGCATCAGATACAGTTGGAGATAAGGACG
GACGTGTGGCAGCTCCCGCAGAGGATTCACTGGAAGTGCATTACCTATCCCATGGGAGCC
ATGGAGTTCGTGGCGCTGGGGGGGCCGGATGCGGGCTCCCCCACTCCGTTCCCTGATGAA
GCCGGAGCCTTCCTGGGGCTGGGGGGGGGCGAGAGGACGGAGGCGGGGGGGCTGCTGGCC
TCCTACCCCCCCTCAGGCCGCGTGTCCCTGGTGCCGTGGGCAGACACGGGTACTTTGGGG
ACCCCCCAGTGGGTGCCGCCCGCCACCCAAATGGAGCCCCCCCACTACCTGGAGCTGCTG
CAACCCCCCCGGGGCAGCCCCCCCCATCCCTCCTCCGGGCCCCTACTGCCACTCAGCAGC
GGGCCCCCACCCTGCGAGGCCCGTGAGTGCGTCATGGCCAGGAAGAACTGCGGAGCGACG
GCAACGCCGCTGTGGCGCCGGGACGGCACCGGGCATTACCTGTGCAACTGGGCCTCAGCC
TGCGGGCTCTACCACCGCCTCAACGGCCAGAACCGCCCGCTCATCCGCCCCAAAAAGCGC
CTGCTGGTGAGTAAGCGCGCAGGCACAGTGTGCAGCCACGAGCGTGAAAACTGCCAGACA
TCCACCACCACTCTGTGGCGTCGCAGCCCCATGGGGGACCCCGTCTGCAACAACATTCAC
GCCTGCGGCCTCTACTACAAACTGCACCAAGTGAACCGCCCCCTCACGATGCGCAAAGAC
GGAATCCAAACCCGAAACCGCAAAGTTTCCTCCAAGGGTAAAAAGCGGCGCCCCCCGGGG
GGGGGAAACCCCTCCGCCACCGCGGGAGGGGGCGCTCCTATGGGGGGAGGGGGGGACCCC
TCTATGCCCCCCCCGCCGCCCCCCCCGGCCGCCGCCCCCCCTCAAAGCGACGCTCTGTAC
GCTCTCGGCCCCGTGGTCCTTTCGGGCCATTTTCTGCCCTTTGGAAACTCCGGAGGGTTT
TTTGGGGGGGGGGCGGGGGGTTACACGGCCCCCCCGGGGCTGAGCCCGCAGATTTAAATA
ATAACTCTGACGTGGGCAAGTGGGCCTTGCTGAGAAGACAGTGTAACATAATAATTTGCA
CCTCGGCAATTGCAGAGGGTCGATCTCCACTTTGGACACAACAGGGCTACTCGGTAGGAC
CAGATAAGCACTTTGCTCCCTGGACTGAAAAAGAAAGGATTTATCTGTTTGCTTCTTGCT
GACAAATCCCTGTGAAAGGTAAAAGTCGGACACAGCAATCGATTATTTCTCGCCTGTGTG
AAATTACTGTGAATATTGTAAATATATATATATATATATATATATCTGTATAGAACAGCC
TCGGAGGCGGCATGGACCCAGCGTAGATCATGCTGGATTTGTACTGCCGGAATTC
- Higher eukaryotic genomes contain large amounts of repetitive DNA. The most abundant
interspersed repeat in the human genome is the Alu element. Alus tend to occur near genes
within the introns or in the regions between genes. In some cases their presence and absence
can fairly accurately show the intron exon structure of a gene. Demonstrate this by performing a
nucleotide nucleotide BLAST search against the Alu data base with the genomic sequence of the human
Von Hippel Lindau syndrome gene, accession AF010238. Note that the exons appear in the BLAST graphic
as places where the Alu elements do not align.
The C. elegans gene SMA-4 is a member of the dwarfins
gene family, which play a role in TGF-mediated signal transduction. In order
to identify potential homologs in other species, use the protein-protein
blast page to perform search against the non redundant protein database (nr) using SMA-4 (accession number P45897)
as the query sequence. Find all chicken (Gallus gallus) proteins that
are similar to SMA-4. ( Use the Tax Blast link at the upper left of the graphic to help in finding the chicken proteins.) Now
run the search again and restrict to chicken proteins through the Entrez query advanced option. What proteins are found?
Compare the Expectation values of these hits to the same hits found against
nr with no organism restriction. Why are the E values different for
the same scores and alignments?
The human fragile histidine triad protein (FHIT) (SWISS-PROT:
P49789) has been shown to be structurally homologous to
galactose-1-phosphate uridylyltransferase. However this relationship is not
apparent in an ordinary BLAST search. Perform a protein-protein
blast search against the
swissprot database with P49789 and search your results for
galactose-1-phosphate uridylyltransferases. Now use PSI-BLAST to verify the
relationship between these two protein families
Find the unannotated genomic scaffold for
Drosophila melanogaster, AE003584,
using Entrez
nucleotides. Display protein links to see the predicted
proteins for this scaffold.
Use the
CDD search to identify conserved domains present in the tenth
predicted
protein (gi: 7295996) and suggest a potential function for this
hypothetical protein.
As the database grows so does the number of chance occurrences
of amino acid motifs that spell out words or people's names in single letter
amino acid codes. One such name motif is ELVIS. Find the number of
occurrences of ELVIS in the protein nr. To get any hits at all, you will
have to adjust several of the advanced BLAST parameters including the Expect
value, Word size and Score Matrix. Adjust some of these in the "Other
advanced options" box. Options are entered command line style. For example,
typing -e 10000 sets the Expect value cut-off to 10000. See the BLAST "Frequently Asked
Questions"
linked on the left side bar of the BLAST page on "How do I perform a
similarity search with a short peptide/nucleotide sequence?" for more
information. We now have a page with presets optimized to find short nearly exact matches. You can cheat and run the search on this page to see the correct parameters to
use.
| |
Genome Resources Questions Top |
- The Mycobacteria are
highly specialized intracellular parasites. They have unusual metabolisms and seem to have acquired genes by horizontal
transfer from their host. You can demonstrate these features by comparing the Mycobacterium tuberculosis genome.
Use the Entrez genomes page to view the genomes of Escherichia coli and
Mycobacterium tuberculosis. (You may want to launch two browsers to do this example.) Display the distribution of BLAST hits by Taxa for each
and compare the distribution of homologs. Which organism has more best hits to Eukaryotes? Now display the BLAST hits for each by COGs (clusters of orthologous groups). The tuberculosis organism has a
disproportionate portion of the genome devoted to metabolism of what class of biomolecules?
mRNA that hybridized to the EST sequence with accession number AI589456
was highly expressed in a human liver tumor sample. Use the human UniGene data
to identify this gene. Link to LocusLink. What is the function of this protein? Go back to
Go back to UniGene. Look at the ESTs in this cluster. How many are
there? Identify a pair of ESTs that come from the same clone ID. Use BLAST
two sequences to align these to the full length RefSeq mRNA from the LocusLink entry. Are there any
mismatches? Another mRNA hybridizes to AI150058. What information can you find about
this gene?
Retrieve the LocusLink entry for human BRCA1. Scroll down to the NCBI Reference
Sequences section. How many splice variants are
reported for this gene's transcripts? Use the sv link on the NCBI contig to see a graphical view that shows these splice variants
more clearly. Scroll up to the mapping section of the report and link to the map viewer
through the mv link.
Use the Display settings link
to add the Contig and the GenBank map to the display. Use the zoom control graphic
to zoom out until the entire contig is displayed. How large is this contig? How many GenBank records were used to construct it?
How many of these are draft and how many are finished records? What other genes are anotated
on this contig? Examine the GenomeScan map in the region of BRCA1. GenomeScan has identified
a gene in one of the introns of BRCA1. This may be a psuedogene for what human protien?
One kind of hereditary hearing loss was recently mapped to a
to a relatively small region on chromosome 6. The gene responsible appears to be between the markers D6S472 (also known as AFMa128yd9) and D6S1722 (also known as
AFMa102ya5). Use the search option on the human map viewer
to find both of these markers. Search with 'D6S472 OR D6S1722'. Display your results by clicking the link
under the chromosome graphic where there are hits. Remove all maps except the Genethon map and add a ruler using the display settings.
Zoom in until you can approximate the distance between these on this Genetic map. How far apart are they? What are the units on
this map? Replace the Genethon map with the STS map. This is the NCBI ePCR map. What are the physical positions of the two markers? Again find the distance between these
markers. What are the units now? Adjust the region
shown to display an interval just spanning these markers. (Enter the distances in thousand of bases, for example 147,000K.) How many STS
markers are in this region? Add the genes on sequence map to the dsiplay. What identified genes are in this region?
Link to LocusLink to see if this gene is now associated with autosomal deafness.
There is set of sodium channel genes in the rat, that seem to have
corresponding genes on chromosome 2 in human. A study by Escayg et
al. used the rat cDNA (accession number M22253) for one of these rat sodium channels to find the
corresponding gene in the human draft sequence with a BLAST search. They further showed that mutations in this gene were involved in an
inherited nuerological disease (generalized epilepsy with febrile seizures plus type 2 (GEFS+2)). Use the human genome BLAST page
to search the draft human genome with the rat cDNA (M22253). How many contigs from chromosome 2 do you hit? Click on the link
corresponding to the best BLAST hit and zoom out until you can see all of these contigs displayed. There are two sodium channel
genes (SCN) annotated on the Gene_Sequence map; what are they? The gene identified by Escayg (SCN1A) and co-workers lies on the q terminal side of these.
What contig contains it? Use the display settings to add the GenBank map. What accession number contains (SCN1A)? Is this draft (HTG) or
finished sequence? Note that there is also another as yet unanotated SCN gene between the annotated gene.
The UniGene collection
is a very useful resource for finding uncharacterized genes that are known only from ESTs. According to the
release statistics only a
minority of the EST clusters contain a known gene. The majority then represent the transcripts of
undiscovered, uncharacterized genes. We should be able to identify these unknown genes in the draft genome
through a BLAST search. Starting from the
UniGene page , retrieve the human UniGene Cluster Hs.333314. How many ESTs are in this cluster? Notice that the
first EST (N93603) is a 3' read. What does the "A" symbol next to this record read mean? There are some cases in this
cluster where both the 3' read and the 5' read are from the same clone. Which ones are these?
The non-EST sequences in this cluster are based on the National Cancer Institute's Mammalian Gene Collection. This is a targeted
resequencing of potentially full-length EST clones. Perform a human genome BLAST
search with the MGC sequence from this cluster (BC006407). On what chromosome and in what region is the corresponding gene?
On what contig is this gene? Look at the GenomeScan and EST maps for addtional support for the presence of this gene.Find a nearby annotated gene.
Glutathione-S-transferases (GSTs) are enzymes involved in a variety of detoxification
processes including the metabolism of carcinogens. Polymorphisms in GST genes including the absence of certain genes have been associated with increased
susceptibily to cancer. There is a cluster of Mu class GST genes on chromosome 1. Use
OMIM in Entrez to find the entry
for GSTM1. Use the link on the left side bar of the OMIM entry to link to the OMIM gene map. What methods were
used to place GSTM1 on the OMIM Gene Map? Follow the link from the OMIM Gene Map to the map viewer
link to the map viewer. Use the display settings to remove the Morbid Map and the Gene_Cytogenetic map from the display
and add the Variation (SNP) map. Make the SNP map the master map. How many polymorphisms are mapped for chromosome
1? Zoom in to a 8K region surrounding GSTM1. Do this by mousing over
the Genes_sequences map and left clicking on the graphic. A menu with various zoom levels will appear. You will
need to zoom in multiple times. You can then adjust the range using the region shown boxes. There are a number of
SNPs associated with the coding region of GSTM1. How many are there? (To see what the symbols mean on the SNP map
click one one of the RefSnp identifiers and link to the RefSNP Summary Info.)
Two of these also occur in the coding regions of two other GSTM members on chromosome 1. Which ones are these?
Use LocusLink to find the the entry for
the human glyceraldehyde 3 phosphate dehydrogenase gene. Click on the map viewer link ( mv)
to find the map location and the contig containing the the GAPD gene. Zoom in to see the exon intron structure of the gene on the gene_seq map. How many exons are there?
Now use human genome BLAST to verify the location and structure of this gene. Use the GAPD RefSeq (NM_002046) to perform this search.
Set both the alignments and descriptions to 250.
How many contigs do you hit in the human genome? Click on the Genome View button to see the distribution of these
hits on the genome. Look at some of the high scoring single hits and to see what's unusual about them. How can you
account for these results?
|